Chikungunya Virus Database (CHKVDb)

Home | Genomes | Genes | Proteins | Protein structures | Phylogenomics | Glycosylation Sites | Therapeutics |
Sr. No CHIKV miR ID miRNA name Mature sequence GC Content(%)
1 CHIKV-M1-5p M1-5p CCGAUUGGCGUACUGGGUAGGG 63.636364
2 CHIKV-M1-3p M1-3p CAUGUACAAUGCCAUGGCGGGU 54.545455
3 CHIKV-M2-5p M1-5p UUUCGUGCGAAGGCUACGUCGU 54.545455
4 CHIKV-M2-3p M2-3p GAGCCCAGGCCUUUACGGAAAA 54.545455
5 CHIKV-M3-5p M3-5p GUCUACAAGAGGCCUGAUACCC 54.545455
6 CHIKV-M3-3p M3-3p UUCAGGCCGAGUUUGACAGCUU 50
7 CHIKV-M4-5p M4-5p UGACAGCUUUGUGGUACCGAGC 54.545455
8 CHIKV-M4-3p M4-3p CUAGAAUCAAAUGGUUGUUAAG 31.818182
9 CHIKV-M5-5p M5-5p AGCGGACGAGCAGGGAGGUAUG 63.636364
10 CHIKV-M5-3p M5-3p CUAGUGCCCUCAGGCUACGCAA 59.090909
11 CHIKV-M6-5p M6-5p UGUACCACAAAAGUAUCUCCAG 40.909091
12 CHIKV-M6-3p M6-3p CUGUGACUGCCAUUGUGUCAUC 50
13 CHIKV-M7-5p M7-5p GGCUAUUUUCUAAACCGUUGGU 40.909091
14 CHIKV-M7-3p M7-3p UAACCACUGGGAUAAUAGGCCU 45.454545
15 CHIKV-M8-5p M8-5p UUGGGUAGCGCCACUAGGUGUC 59.090909
16 CHIKV-M8-3p M8-3p ACCUAGAGUUGGGUCUGCCAGC 59.090909
17 CHIKV-M9-5p M9-5p UGCAGCCUUUGUAGGACAGGCC 59.090909
18 CHIKV-M9-3p M9-3p CGUCGUACCGGGUAAAACGCAU 54.545455
19 CHIKV-M10-5p M10-5p CUAUCCAACUGUUUCAUCAUAC 36.363636
20 CHIKV-M10-3p M10-3p UAUCUAGACAUGGUGGACGGGU 50
21 CHIKV-M11-5p M11-5p UCAGCAGUAUUCAACGUGGAGU 45.454545
22 CHIKV-M11-3p M11-3p UGCAACCAAGAAUACUGGGAAG 45.454545
23 CHIKV-M12-5p M12-5p AUGAUUCACUUGCGCUUACUGC 45.454545
24 CHIKV-M12-3p M12-3p GGAUUUAGGGGUGGAUCACUCC 54.545455
25 CHIKV-M13-5p M13-5p CAUGAUGAAAUCUGGUAUGUUC 36.363636
26 CHIKV-M13-3p M13-3p CACUGCUAAAUAUCACCAUCGC 45.454545
27 CHIKV-M14-5p M14-5p AGCCUUCAUCGGCGACGACAAC 59.090909
28 CHIKV-M14-3p M14-3p GUCUCCGAUGAAUUGAUGGCAG 50
29 CHIKV-M15-5p M15-5p GGUGGCCAUAGUCUUAGGAGGA 54.545455
30 CHIKV-M15-3p M15-3p CAGCCCUCUCAGUGGUGACCUG 63.636364
31 CHIKV-M16-5p M16-5p CGGUGCGGUAUAAGUGUAAUUG 45.454545
32 CHIKV-M16-3p M16-3p AGUGAUUAAUAACUGCAAGGUU 31.818182
33 CHIKV-M17-5p M17-5p UACCCUACUAUGACUGUAGUAG 40.909091
34 CHIKV-M17-3p M17-3p ACUCCUGUCGAUGGUGGGUAUG 54.545455